Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 2. The dynamic expression of miRNA genes during liver develop- ment. (A) Based on the expression pattern of each miRNA, miRNA clus- ters consisting of expression enriched in foregut (Cluster A), hepatoblast (Cluster H), and adult liver (Cluster L) were identified. (B) Validation of mir302b and mir24 expression by qRT-PCR. U6 was used as an endoge- nous control. All data presented are representative of at least three inde- pendent experiments.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Expressing, Biomarker Discovery, Quantitative RT-PCR, Control

Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 3. mir302b is expressed in the endoderm at the time of organogenesis. (A,C) mir302b expression in early streak embryo (E6.5); lateral view (A) and transverse section (C). (B,D) mir302b expression in E7.5 embryo; lateral view (B) and transverse section (D). (E,F) Lateral view of mir302b expression in 3-somite stage embryo (E8.5) (E) and transverse sections (F). a, anterior; p, posterior; Epi, epiblast; m, mesoderm; ve, visceral endoderm; en, endoderm; PS, primitive streak; n ect, neural ectoderm; ect, ectoderm; Fg, foregut. All data presented are representative of at least three independent experiments.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Expressing

Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 4. mir302b is expressed in the whole endoderm at E8.75. (A-D) mir302b expression in E8.75 embryo; lateral view (A) and transverse sections (B-D). nt, neural tube; ht, heart; a, allantois. All data presented are representative of at least three independent experiments.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Expressing

Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 5. mir302b and mir20a tar- get genes contributing to Tgfb sig- naling. (A) 30UTR sequences from Tgfbr2 and Kat2b showing the pre- dicted miRNA binding regions were cloned into luciferase vectors. The numbers indicate the distance (base) to stop codon of each gene. Mutated versions are shown below. (B) Relative luciferase activity of Tgfbr2 or Kat2b wildtype (WT), mu- tant (Mut) and backbone (Vector) reporters transfected into HEK293T cells containing mir302b overex- pression vector (302b_OE, :) or its control vector (Ctrl_OE, ), or mir20a knockdown vector (20a_KD, ;) or its control vector (Ctrl_KD, þ). (C) Western blot showing levels of Tgfbr2 in HEK293T cells transfected with 302b_OE, Ctrl_OE, 20a_KD, or Ctrl_KD. Numbers under each band show relative quantification. All data presented are representative of at least three independent experiments.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Binding Assay, Clone Assay, Luciferase, Activity Assay, Plasmid Preparation, Transfection, Control, Knockdown, Western Blot

Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 6. mir302b and mir20a repress TGFb signal transduction. Luciferase activity of the TGFb responsive reporter, 3TP-lux, 48h after transfec- tion of HEK293T cells with mir302b_OE (:), Ctrl_OE (), mir20a_KD (;), Ctrl_KD (þ), pBOS (), pBOS-Tgfbr2 (þ), or pBOS-Tgfbr2(DN) (þ) in the presence (þ) or absence () of TGFb. Mean values in row with same letter are not significantly different. Values in row with different letters are significantly different.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Transduction, Luciferase, Activity Assay

Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 7. Ectopic expression of mir302b in ESC differentiation. A lentiviral vector-based system was employed to ectopically express mir302b. Lentivirus generated from the control vector (pCDH) or mir302b overexpression vector (pCDH302b) was added at day 6 (d6) of differentiation. The expression of mir302b, mir20a, and Tgfbr2 during ESC differentiation with pCDH or pCDHmir302b virus was analyzed by qRT-PCR. All data presented are representative of at least three independent experiments.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Expressing, Plasmid Preparation, Generated, Control, Over Expression, Virus, Quantitative RT-PCR

Journal: Hepatology (Baltimore, Md.)

Article Title: Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling.

doi: 10.1002/hep.26252

Figure Lengend Snippet: Fig. 8. Forced expression of mir302b represses liver development in ESC differentiation. The expression of liver markers, Alb, Afp, Hnf4a, Ttr, Hpx, and Serpina1a, were detected at the end of the differentiation. All data presented are representative of at least three independent experiments.

Article Snippet: The mir302b overexpression vector, pCMV-mir302b-IRES-GFP (302b_OE), and its control vector, pCMV-mir-IRESGFP (Ctrl_OE), were purchased from Origene.

Techniques: Expressing

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: The rs2863002 SNP alters the binding site for the transcription factor GATA3. A) The graph shows the combined results of the TF motifs enrichment analysis (‐Log10P, y‐axis) and the FABIAN scores related to the alteration of the TF binding motifs due to rs2863002 (FABIAN, x‐axis). Each dot represents a TF binding motif with color and size related to the score obtained with the FABIAN prediction tool, while the dotted lines represent the threshold values chosen to classify TF motif disruption (red) or gain (blue). B) ChIP‐seq tracks for GATA3 TF obtained from neuroblastoma cell lines. The image shows rs2863002 at chr11:43 714 768 (hg19/GRCh37) in correspondence with in‐house generated (dark blue) and publicly available (light blue) GATA3 ChIP‐seq data from neuroblastoma cell lines deposited in the GEO database. Data ranges are shown on the left, while neuroblastoma cell lines are reported on the right. C) Chromatin fold enrichment obtained in GATA3 ChIP qPCR experiments carried out in SH‐SY5Y and NMB cells. We report the chromatin fold enrichment obtained for a negative (chr5:24682868–24682979) and a positive (chr2:15982438–15982518) control region for GATA3 binding, respectively in blue and violet, and for the genomic region of rs2863002 in pink. Enrichment measurements are folded on Rabbit IgG and represent the mean ±SD from three independent experiments. D) Chromatin fold enrichment obtained in GATA3 ChIP qPCR experiments carried out in SK‐N‐BE(2) wild‐type cells and relative CRISPR/cas9 edited clones (clone#1, #2, and #3). We report the chromatin fold enrichment obtained for a negative and a positive DNA control region for GATA3 binding, and for the genomic region of rs2863002, as in (B). ns not significant; * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Binding Assay, Disruption, ChIP-sequencing, Generated, ChIP-qPCR, Control, CRISPR, Clone Assay

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: The rs2863002 SNP acts as an enhancer in neuroblastoma cells, positively influencing HSD17B12 expression. A) Luciferase reporter gene assays were carried out in the SH‐SY5Y, SH‐EP, and HEK293 cell lines. Luciferase activity of the constructs harboring the C and T alleles of rs2863002 was compared to a PGL3 empty control vector. The results are expressed as relative luminescence units (RLU) and the ratio between firefly/renilla luciferases provided the normalized luciferase activity for each vector. Data represent the mean ± SD of three independent experiments and p ‐values were obtained by t ‐test. B,C) Violin plots showing the median expression of HSD17B12 according to rs2863002 genotypes in adrenal gland tissue (GTEx portal) (B), and in the TARGET database of neuroblastoma patients (C). D) Hi‐C results obtained in SK‐N‐BE(2)C neuroblastoma cell line, showing the genomic region including rs2863002 on genome assembly hg19/GRCh37. The interaction matrix is centered on rs2863002 at chr11:43 714 768 and extended of 0.4 Mb up‐ and down‐stream. Genomic coverage is 500Kb and the matrix resolution is 10Kb. Red triangles represent the Topologically Associated Domains (TADs). The genomic tracks displayed from top to bottom are: the arcs track showing the interactions between rs2863002 and the up‐stream annotated bins; the normalized number of interactions; the minus Log10 of the FDR adjusted p ‐values; the NCBI RefSeq genes. A brown‐bordered rectangle highlights the HSD17B12 locus. E) Representative western blot image of HSD17B12 expression in SK‐N‐BE(2) wild‐type and CRISPR/Cas9‐edited clones. β‐Actin protein level was used as the loading control. F,G) Quantitative measurements of HSD17B12 protein (F) and mRNA (G) expression in SK‐N‐BE(2) wild‐type and CRISPR/Cas9‐edited clones. H) Correlation analysis of HSD17B12 and GATA3 expression from R2 Genomics ( GSE62564 ). R, correlation coefficient; P, p ‐value. I) Western blot images of GATA3 and HSD17B12 protein levels after 72 h of GATA3 siRNA transfection in SH‐SY5Y, NMB, and SK‐N‐BE(2)C. ns non‐significant; * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Expressing, Luciferase, Activity Assay, Construct, Control, Plasmid Preparation, Hi-C, Western Blot, CRISPR, Clone Assay, Transfection

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: HSD17B12 is an oncogenic driver enhancing cell growth and invasion in neuroblastoma. A,B) HSD17B12 efficient silencing was measured by western blot (A) and qRT‐PCR (B) in SH‐SY5Y and NMB neuroblastoma cell lines 72 h post siRNA transfection. Data represent the mean ±SD from three independent experiments. C,D) Assessment of cell proliferation in SH‐SY5Y and NMB cell lines after silencing of HSD17B12 (C) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (D). Cell viability measurements were performed using MTT assays at 0, 24, 48, and 72 h post siRNA transfection (C) or after seeding (D). Data shown are the mean ±SD from two independent MTT experiments, with six technical replicates for each experimental point. E,F) Representative images of trans‐well invasion assays performed in SH‐SY5Y and NMB cell lines after silencing of HSD17B12 (E) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (F). G,H) Number of invasive cells as measured in SH‐SY5Y and NMB silenced cell lines (G) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (H). Data represent the mean ±SD from two independent experiments. * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values obtained by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Western Blot, Quantitative RT-PCR, Transfection, CRISPR, Clone Assay

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: Down‐regulation of HSD17B12 alters lipid molecules affecting the fluidity of membranes and lipid droplet properties. A,B) Membrane fluidity was assessed by measuring the ratio of pyrene‐decanoic acid (PDA) excimer to monomer fluorescence in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (A) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (B). Fluorescence was evaluated at 400 nm for monomers and 470 nm for excimers. Data represent the mean ± SD of the measurements compared with control conditions (siScrambled) in (A) and SK‐N‐BE(2) wild type in (B) each from two independent experiments performed in duplicate. C,D) Representative confocal images of neutral lipid staining by LipidTOX Green (green) in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (C) and in SK‐N‐BE(2) wild‐type cells and edited clones (D). Nuclei were counterstained with DRAQ5 (blue). Scale bar 20 µM. E,F) Quantification of lipid droplet number obtained through cell‐by‐cell measurements in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (E) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (F). Data represent the mean number ± SD of lipid droplets per cell; measurements have been performed on a mean number of 100 cells per experimental condition. * p ‐value < 0.05; ** p ‐value < 0.01. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Membrane, Fluorescence, CRISPR, Clone Assay, Control, Staining

Journal: Nature

Article Title: Hypothalamic Programming of Systemic Aging Involving IKKβ/NF-κB and GnRH

doi: 10.1038/nature12143

Figure Lengend Snippet: a–c Hypothalamic GnRH mRNA of indicated mice. d–g . GT1–7 cells were transfected with CA IKKβ, RelA or DN IκBα vs. control (Con) plasmid (d,e,g) , co-transfected with GnRH -promoter luciferase plasmid (e&f) , or together with RelA shRNA (sh-RelA) vs. control shRNA (sh-Con) plasmid (f) , and were measure for GnRH release (d) , GnRH promoter (e&f) , and c-Fos , c-Jun , PKCα and PKCδ mRNA levels (g). h . GnRH promoter activities were measured for GT1–7 cells transfected with GnRH -promoter luciferase plasmid, co-transfected with c-Jun or c-Fos plasmid vs. control plasmid (Con), or treated with TPA vs. vehicle (Veh). i . GnRH promoter activities were measured for GT1–7 cells transfected with GnRH -promoter luciferase plasmid, co-transfected with CA IKKβ vs. control (Con) plasmid, and with c-Fos /c- Jun shRNA plasmids (sh-c-Fos/sh-c-Jun) vs. scramble shRNA control (sh-Con). j . Summarized schematic model. *P < 0.05, **P < 0.01, ***P < 0.001; n = 12 (a&e) and 3 (f–i) per group, and n = 6 (b) , 8 (c) and 4 (d) in Con, n = 8 (b) and 6 (d) in IKKβ, and n = 8 (c) and 6 (d) in IκBα. Error bars reflect mean ± SEM.

Article Snippet: RelA shRNA and control (GFP) shRNA vectors were obtained from Addgene (# 22507, 22508, and 31848), as studied in the literature (RelA shRNA: GCA-TGC-GAT-TCC-GCT-ATA-A, control shRNA: ACA-GCC-ACA-ACG-TCT-ATA-T).

Techniques: Transfection, Control, Plasmid Preparation, Luciferase, shRNA

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: Trim32 is selectively expressed in inner EGL and displays an uneven cytoplasmic distribution during GNP differentiation. a RT-qPCR analysis of Trim32 in P0, P7, P14, and adult mouse cerebella. Data are expressed as means ± SD (n = 3). An asterisk indicates P < 0.05 and triple asterisks indicate P < 0.001. b Immunoblotting analysis of Trim32, Gli1, and MycN in P0, P7, P14, and adult mouse cerebellums. c Immunofluorescence staining of Trim32 (red) in the EGL of P7 Math1-GFP transgenic mouse cerebellum. Nuclei were counterstained with DAPI (blue). EGL external granule layer, ML molecular layer, PCL Purkinje cells layer, and IGL internal granule layer. The scale bars represent 100 µm in the first panel and 25 µm in the second panel. d Confocal analysis (left) and quantification of immunofluorescence intensities (right) of distribution of Trim32 (green) in the dividing GNPs in different phases of the cell cycle. The dashed line highlights the cells that are in the indicated phase of cell cycle. The cell-cycle phases were identified by PH3 staining (red) for DNA. Nuclei were counterstained with DAPI (blue). The scale bars represent 10 µm. Data are expressed as means ± SD (n = 3). ns indicates P > 0.05 and triple asterisks indicate P < 0.001

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: Quantitative RT-PCR, Western Blot, Immunofluorescence, Staining, Transgenic Assay

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: Trim32 knockout enhances GNP proliferation in the postnatal developing cerebellum. a Expression of the Math1-GFP protein (GFP, green) in P7 mouse cerebellar sections from the Math1-GFP/Trim32wt mice and Math1-GFP/Trim32KO mice. Nuclei were counterstained with DAPI (blue). Graph in a representing Math1 positive cells normalized to the length of the EGL edge. The scale bar represents 25 µm. Immunofluorescence staining of NeuN (red, b) and Ki67 (red, c) in P7 mouse cerebellar sections from the Math1-GFP/Trim32wt mice and Math1-GFP/Trim32KO mice. Nuclei were counterstained with DAPI (blue). Graph in b and c respectively representing NeuN or Ki67-positive cells normalized to the length of the EGL edge. The scale bar in b represents 50 µm. The scale bar in c represents 25 µm. oEGL outer external granule layer, iEGL inner external granule layer, ML molecular layer, and IGL internal granule layer. d P7 and P18 cerebellar midsagittal sections were stained for DAPI to show the overall morphology of cerebellum in Trim32wt mice and Trim32ko mice. The scale bar represents 500 µm

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: Knock-Out, Expressing, Immunofluorescence, Staining

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: Trim32 antagonizes the SHH signaling activity. a RT-qPCR analysis of Trim32, the granule neuronal progenitor marker Maht1, and SHH target genes in P7 cerebellar granule neuronal progenitors (cGNPs) from Trim32wt mice and Trim32KO mice. Data are expressed as means ± SD (n = 3). Double asterisks indicate P < 0.01 and triple asterisks indicate P < 0.001. b Immunoblotting analysis of Trim32, Gli1, Ccnd1, Ccnd2, and MycN in P7 mouse cerebellum from Trim32wt mice and Trim32KO mice. c, d RT-PCR mRNA expression of the SHH target genes Gli1 and MycN in HEK293T cells overexpressing Trim32-GFP or GFP control vector. The cells were cultured with or without SHH for 24 and 48 h. Data are expressed as means ± SD (n = 3). Double asterisks indicate P < 0.01 and triple asterisks indicate P < 0.001. Gli-RE-luciferase activity in human medulloblastoma cell line D283 (e) and HEK293T cells (f), following transfected the indicated vectors. The luciferase activity was evaluated relative to Renilla activity. The means ± SD from three experiments are shown

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: Activity Assay, Quantitative RT-PCR, Marker, Western Blot, Reverse Transcription Polymerase Chain Reaction, Expressing, Control, Plasmid Preparation, Cell Culture, Luciferase, Transfection

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: Trim32 interacts with Gli1 though the NHL domain. a In vivo assay for binding between Trim32 and Gli1. Expression vectors encoding TRIM32-GFP and Flag-tagged Gli1 were transfected into HEK293T cells. Whole cell lysates were immunoprecipitated with anti-Trim32 or anti-FLAG antibody and immunoblotted with anti-Trim32 and anti-Gli1 antibodies. b Co-immunoprecipitation of exogenously expressed Trim32-HA with the endogenous Gli1 in HEK293T cells. c Co-immunoprecipitation of exogenously expressed Trim32-GFP with the Gli1 truncated mutants. d Schematic drawing of full-length Trim32 (Trim32-wt) and deletion mutants. Trim32 contains a RING finger (R), two B-boxes (B), a coiled-coil region (Coil), and an NHL domain (NHL). e Co-immunoprecipitation of exogenously expressed Flag-tagged Gli1 with the Trim32 truncated mutants shown as in d

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: In Vivo, Binding Assay, Expressing, Transfection, Immunoprecipitation

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: Trim32 promotes Gli1 ubiquitination and degradation. a HEK293T cells transfected with Gli1 and increasing doses of Trim32 were collected for immunoblotting with the indicated antibodies. b Quantification of Gli1 and Trim32 protein levels (normalized to actin) from a. The means ± SEM from three experiments are shown. c Cells stably expressing scramble RNA or shRNA targeting Trim32 (#1, #2) were harvested for immunoblotting with the indicated antibodies. d HEK293T cells were transfected with plasmids encoding Flag-tagged Gli1 and control GFP vector or Trim32 or Trim32-ΔR, treated with 20 µg/ml cycloheximide (CHX) and harvested at the indicated times points. The levels of Gli1 and Trim32 in the lysates were investigated by immunoblotting. e Quantification of Gli1 remaining protein levels (normalized to actin) from d. The means ± SEM from three experiments are shown. f Cells were transfected with scramble RNA or shRNA targeting Trim32 (#1), treated with 20 µg/ml cycloheximide (CHX), collected at the indicated time points, and then immunoblotted with the indicated antibodies. g Quantification of Gli1 protein levels (normalized to actin) from f. The means ± SEM from three experiments are shown. h Cells transfected with Gli1 or Trim32 were treated with or without 10 µM MG132 for 8 h, collected, and then immunoblotted with the indicated antibodies. Graph representing quantification of Gli1 protein levels (normalized to actin). i Anti-ubiquitin immunoblotting of immunoprecipitated exogenous Gli1 in HEK293T cells transfected with the indicated plasmids. j The effect of Trim32-wt or Trim32 deletion mutant (Trim32-ΔR) to the activation of Gli-RE-luciferase induced by Gli1 in HEK293T cells. The means ± SD from three experiments are shown. Double asterisks indicate P < 0.01

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: Ubiquitin Proteomics, Transfection, Western Blot, Stable Transfection, Expressing, shRNA, Control, Plasmid Preparation, Immunoprecipitation, Mutagenesis, Activation Assay, Luciferase

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: Trim32 knockout increases the incidence of MB in Ptch1+/− mice. Quantitative PCR mRNA (a; mean ± SD; n = 9) and protein levels (b; n = 3) of Trim32 in mouse medulloblastomas (MB) from Ptch1+/− mice and normal cerebella. c RNA expression level of Trim32 negatively correlated with Gli1 (n = 51) in human SHH MB samples. Data are analyzed from Oncomine database. d Kaplan–Meier analysis of MB incidence in 63 Ptch1+/−/Trim32wt mice (gray line) versus 17 Ptch1+/−/Trim32KO mice (black line). Ptch1+/−/Trim32wt mice and Ptch1+/−/Trim32KO mice, obtained by interbreeding for at least three generations the progeny of Ptch1 heterozygous and Trim32 knock-out mice, were then monitored for the onset of medulloblastoma; (triple asterisks indicate P < 0.001, Logrank test). e Expression of the Math1-GFP protein (GFP, green) in the Math1-GFP mouse medulloblastomas and adjacent cerebellar cortices sections from Ptch1+/−/Trim32wt mice and Ptch1+/−/Trim32KO mice. Nuclei were counterstained with DAPI (blue). The scale bar represents 200 µm. MB medulloblastoma, IGL internal granule layer. RT-qPCR analysis of SHH target genes (f), Trim32 (g), the granule neuronal progenitor marker Maht1 (h), and the differentiated granule cell markers including Tuj1 and NeuN (i) in adult mouse cerebellums and medulloblastomas from Ptch1+/−/Trim32wt mice and Ptch1+/−/Trim32KO mice. Data are expressed as means ± SD (n = 3). An asterisk indicates P < 0.05, double asterisks indicate P < 0.01, and triple asterisks indicate P < 0.001. j Immunoblotting analysis of Trim32, Gli1, Ccnd2, MycN, and NeuN in MB from Ptch1+/−/Trim32wt mice and Ptch1+/−/Trim32KO mice

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: Knock-Out, Real-time Polymerase Chain Reaction, RNA Expression, Expressing, Quantitative RT-PCR, Marker, Western Blot

Journal: Cell Death and Differentiation

Article Title: Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling

doi: 10.1038/s41418-019-0415-5

Figure Lengend Snippet: mRNA expression analysis

Article Snippet: The full-length or truncated Trim32 cDNA were amplified by PCR from the Trim32 cDNA plasmid, and then cloned to an expression vector pCMV6-AC-GFP (#PS100010, OriGene) respectively.

Techniques: Expressing

Journal: Molecular Therapy. Nucleic Acids

Article Title: miRNA-31 Improves Cognition and Abolishes Amyloid-β Pathology by Targeting APP and BACE1 in an Animal Model of Alzheimer’s Disease

doi: 10.1016/j.omtn.2020.01.010

Figure Lengend Snippet: Expression of miR-31 Decreases APP and Bace1 Expression Levels (A) Schematic representation of the predicted binding sites of the miRNAs in the 3′ UTR of genes of interest. miR-17-3p, miR-31-5p, miR-200c-3p, and miR-497-3p are predicted to bind the 3′ UTR of human APP mRNA, while miR-31-5p and miR-497-3p are also predicted to bind the 3′ UTR of mouse Bace1 mRNA. Additionally, miR-31-5p has a putative binding site in the CDS of human APP mRNA encoding the APP695 protein isoform. (B–D) Biochemical validation of putative binding sites was performed employing the luciferase assay. (B) miR-17-3p, miR-31-5p, miR-200c-3p, and miR-497-3p reduced luciferase activity upon co-transfection with the human 3′ UTR APP plasmid in HEK293 cells. NMC, miR-17, and miR-200c, n = 4; miR-31 and miR-497, n = 2. (C and D) miR-31-5p was also able to reduce luciferase activity in HT-22 and HEK293 cells, upon co-transfection with the mouse 3′ UTR Bace1 and human CDS APP plasmids, respectively. (C) NMC and miR-31, n = 5; miR-497, n = 2; (D) NMC and miR-31, n = 3. (E) Schematic representation of lentiviral plasmid (pLenti) construction encoding the selected pri-miRNA sequences. (F) Validation of pLenti constructions was performed in HEK293 and HT-22 cells by evaluating the expression of the GFP reporter gene through fluorescence microscopy (original magnification, ×200) and (G–J) quantifying the mRNA levels of human APP and mouse Bace1 by qRT-PCR. (G) mRNA levels of human APP were significantly decreased in HEK293 cells upon transfection with all miRNA-pLenti vectors, while (H) mRNA levels of mouse Bace1 were significantly decreased in HEK293 cells upon transfection with the miR-31 pLenti construct. (G) pNC, pmiR-17, pmiR-31, and pmiR-200c, n = 3; pmiR-497, n = 2; (H) pNC, pmiR-31, and pmiR-497, n = 3. (I and J) The mRNA levels of human APP (I) and mouse Bace1 (J) were also significantly decreased in SH-SY5Y and HT-22 cells, respectively, upon infection with lentiviral particles encoding miR-31. Non-infected cells (Uninf.) and miR-31 lentivirus (LV miR-31), n = 3. Each n represents a temporarily independent experiment performed in duplicate. Data represent mean ± SEM. *p < 0.05, **p < 0.01, ****p < 0.0001 with respect to the control condition, that is, transfection with (B–D) control mimic (NCM), (G and H) pLenti control vector (pGFP), or (I and J) non-infected cells. (B, C, G, and H) Ordinary one-way ANOVA with Dunnett’s post hoc test. (D, I, and J) Two-tailed unpaired t test.

Article Snippet: The pIS0 (#12178), used for insertion of APP CDS, and the pENTR/pSUPER+ (#17338) and pLenti CMV GFP DEST (#19732) vectors, used for lentiviral production, were purchased from Addgene (USA).

Techniques: Expressing, Binding Assay, Biomarker Discovery, Luciferase, Activity Assay, Cotransfection, Plasmid Preparation, Fluorescence, Microscopy, Quantitative RT-PCR, Transfection, Construct, Infection, Control, Two Tailed Test

Journal: Scientific reports

Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process.

doi: 10.1038/srep03852

Figure Lengend Snippet: Figure 1 | (A). Microscopic findings (2003 magnification) of 520d-HLF cells cultured in RPMI1640, with a similar phenotype to pluripotent spheroid cells, GFP expression (bottom middle) and Oct4 expression (bottom right). 520d-HLF cells cultured in ReproStem were spherical (top middle; 2003 magnification) and expressed Nanog (top right). HLF are also shown (top left: 403 magnification). (B). The relative ratio of the 520d-HLF to mock-HLF mRNA levels was compared with respect to representative genes at three days post-transfection. Oct4, Nanog and p53 were significantly upregulated (N 5 9). (C). Western blotting showed that the p53 and Oct4 protein levels in 520d-HLF cells were upregulated compared with those in mock-HLF cells, but the Alb, AID and Dicer1 levels were downregulated. (D). The invasive abilities of mock-HLF and 520d-HLF cells were estimated in a migration assay, using a fibronectin membrane. Most of the 520d-HLF cells could not pass through the membrane. (E). 520d-HLF cells proliferated in a characteristic network structure (403 magnification). (F). FACS analysis showed that the GFP-positive 520d-HLF cells (right) had a higher DNA content in the S phase than the GFP-positive mock-HLF cells (left). (G). The relative ratios of transcriptional expression in 520d-HLF cells that were cultured for one week after transfection with hiPSCs are depicted. Numbers above the upper bars indicate the average ratios. 520d-HLF cells expressed Alb, Nanog, hTERT, PROM1 and c-Myc at similar levels to those in hiPSCs, whereas the p53, RGM249 and Oct4 levels were upregulated in 520d-HLF (n 5 9). (H). To sort PE-positive HLF cells, ALP-PE (1) and GFP (1/2) cells were selected, as indicated by the arrows, and maintained in an immature state for two weeks after sorting. (I). ALP-PE (1) populations showed stable Nanog expression (2003 magnification). The cells grew slowly and expanded even under culture conditions intended to maintain an immature state. (J). To confirm the effects of miR-520d-5p on Nanog, AID, p53 and Oct4 gene expression, the relative expression levels were estimated with siRNA for miR-520d-5p (si-520d; left) or miR-520d-5p (520dOE; right; n 5 4). OE: overexpression. **: P , 0.01: the Mann– Whitney U test.

Article Snippet: To confirm the effects of Oct4, Nanog and p53 upregulation SCIENTIFIC REPORTS | 4 : 3852 | DOI: 10.1038/srep03852 11 and AID downregulation in HLF cells, lentiviral vectors (FU-tet-hOCT4, Efla_NANOG_Ires-Puro and GFP-p53) were purchased from Addgene (Cambridge, MA, USA), while shAID-pLKO.1 was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA).

Techniques: Cell Culture, Expressing, Transfection, Western Blot, Migration, Membrane, Gene Expression, Over Expression, MANN-WHITNEY

Journal: Scientific reports

Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process.

doi: 10.1038/srep03852

Figure Lengend Snippet: Figure 4 | An average hmC (%) was estimated to understand the general methylation level during the miR-520d-5p-induced de-differentiation process. The induction of slight hypermethylation in 5D and a decreasing methylation level in 7D cells were observed (top left). The average methylation rate in HLF cells was 0.45%, and the data were standardized to the results obtained for HLF cells. During the inductive process from HLF to iPS-like cells, mediated by miR-520d-5p, the expression levels of p53, Nanog, AID, ELAVL2 and SIRT1 were examined by RT-PCR. The data were standardized and compared to HLF (n 5 4).

Article Snippet: To confirm the effects of Oct4, Nanog and p53 upregulation SCIENTIFIC REPORTS | 4 : 3852 | DOI: 10.1038/srep03852 11 and AID downregulation in HLF cells, lentiviral vectors (FU-tet-hOCT4, Efla_NANOG_Ires-Puro and GFP-p53) were purchased from Addgene (Cambridge, MA, USA), while shAID-pLKO.1 was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA).

Techniques: Methylation, Expressing, Reverse Transcription Polymerase Chain Reaction

Journal: Scientific reports

Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process.

doi: 10.1038/srep03852

Figure Lengend Snippet: Figure 5 | Whether siELAVL2 and miR-520d induced similar effects in HLF cells was examined. (A). Representative predicted hsa-miR-520d-5p target genes are shown. Four algorithms predicted 6 genes, as shown in a Venn diagram. ELAVL2 was examined as a possible targeted gene. (B). Two days after transfection with siELAVL2, colonies with spherical phenotypes emerged in a thick-Matrigel-coated culture dish (left, 403 magnification; right, 1003 magnification). One week after transfection, the sizes of the central spherical colonies did not change, but cell growth was observed to radiate in all directions. (C). RT-PCR and (D). western blotting revealed upregulated levels of p53, Oct4 and Nanog (n 5 4). The white bar represents 200 mm. (E). Upregulation of both Oct4 (top) and Nanog (bottom) were confirmed by immunocytochemistry. Oct4 or Nanog expression in controls (parental HLF and scramble-HLF) is also shown in Supplementary Fig. S8. (F). The cells were cultured under the following conditions: (top) standard medium (RPMI1640/10% FCS) and (bottom) ReproStem medium with 10 ng/ml of bFGF. The cells cultured under different conditions exhibited entirely different phenotypes. However, the DNA contents of these populations indicated a shift toward homogeneous proliferation, with fewer apoptotic cells. (G). A spheroid cell that was shown in (B) grew slowly and scattered over the entire culture dish surface in approximately two weeks. Scattered spheroid colonies were interlinked through long, branched groups of cells (bottom); mock-HLF is also shown (top). (H). Using a luciferase reporter expression assay, two potent miR-520d-5p binding sites in the 3’UTR of the ELAVL2 gene were identified as 1853–1880 and 2235–2249. The minus sign (2) in the synthesized miR-520d-5p represents synthesized miR-520d-3p, and the minus sign in pMIR-520d-5p represents the control vector with mismatch sequences within miR-520d-5p, which was expressed from pMIR-520d-5p (n 5 4). (I). In the in vivo study, siELAVL2-HLF cells generated differentiated specimens that comprised mesenchymal system components (2/16), but a neoplastic property was indicated via the uniform pattern, accompanied by an irregular-spindle shape (2/16). The remaining phenotypes showed scar tissue or no tumors (12/16). *: P , 0.05 and **: P , 0.01 with the Mann-Whitney U test.

Article Snippet: To confirm the effects of Oct4, Nanog and p53 upregulation SCIENTIFIC REPORTS | 4 : 3852 | DOI: 10.1038/srep03852 11 and AID downregulation in HLF cells, lentiviral vectors (FU-tet-hOCT4, Efla_NANOG_Ires-Puro and GFP-p53) were purchased from Addgene (Cambridge, MA, USA), while shAID-pLKO.1 was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA).

Techniques: Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunocytochemistry, Expressing, Cell Culture, Luciferase, Binding Assay, Synthesized, Control, Plasmid Preparation, In Vivo, Generated, MANN-WHITNEY

Journal: Scientific reports

Article Title: Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process.

doi: 10.1038/srep03852

Figure Lengend Snippet: Figure 6 | In somatic cells, AID upregulation can induce carcinogenesis through p53 mutations and subsequent downregulation, and can thus lead to the downregulation of Nanog and Oct4 and differentiation through methylation. In pluripotent normal cells, Nanog and Oct4 can maintain their upregulated status through an inability of the AID protein to bind to the promoter regions of both Oct4 and Nanog. In cancer cells, AID upregulation can maintain malignancy through Nanog, Oct4 and p53 downregulation. On the other hand, the AID protein did not bind the demethylated promoter regions of activated Oct4 and Nanog in ES cells (top). Both somatic cells and undifferentiated cancer cells were transfected with miR-520d-5p, but AID downregulation could not induce p53 downregulation by inhibiting the p53 mutation status and carcinogenesis. Simultaneously, Nanog and Oct4 upregulation might induce de-differentiation (or pluripotency) and benignancy by maintaining demethylation (bottom). Therefore, miR-520d-5p can presumably induce Nanog, Oct4 and p53 upregulation in both normal cells and cancer cells.

Article Snippet: To confirm the effects of Oct4, Nanog and p53 upregulation SCIENTIFIC REPORTS | 4 : 3852 | DOI: 10.1038/srep03852 11 and AID downregulation in HLF cells, lentiviral vectors (FU-tet-hOCT4, Efla_NANOG_Ires-Puro and GFP-p53) were purchased from Addgene (Cambridge, MA, USA), while shAID-pLKO.1 was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA).

Techniques: Methylation, Transfection, Mutagenesis